View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9704_high_24 (Length: 232)
Name: NF9704_high_24
Description: NF9704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9704_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 102 - 216
Target Start/End: Complemental strand, 425510 - 425396
Alignment:
| Q |
102 |
ggttgcaattgtgtggtttaatttaattaatctttagattcactcctacatcggtgtgaattttggcatcttgttactgcctgctttaatgtgattaaag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
425510 |
ggttgcaattgtgtggtttaatttaattaatctttagattcactcctacatcggtgtgaattttggcatcttgttactgcctgctttaatgtgattaaag |
425411 |
T |
 |
| Q |
202 |
gacaaaagaataatt |
216 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
425410 |
gacaaaagaataatt |
425396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 75
Target Start/End: Complemental strand, 425584 - 425522
Alignment:
| Q |
12 |
gcaaagggggaagttgtcaataatggcnnnnnnnggaacccaacttgctcaacattttccttct |
75 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
425584 |
gcaaagggggaagttgtcaataatggcaaaaaa-ggaacccaacttgctcaacattttccttct |
425522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University