View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9704_high_25 (Length: 229)
Name: NF9704_high_25
Description: NF9704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9704_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 43217370 - 43217147
Alignment:
| Q |
1 |
actaaatacttatttaaacctaaaaatattattgagcatatnnnnnnn-gttacatgaggaatgtgtctagattttgagggattggattgaggaggagga |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43217370 |
actaaatacttatttaaac-taaaaatattattgagcatataaaaaagagttacatgaggaatgtgtctagattttgagggattggattgaggaggagga |
43217272 |
T |
 |
| Q |
100 |
g---------aaagagtatttttagggtttgagggtttgttgcggaaagccaatattcgcgttggggggtcggcggcttccgagagttttttctggtaga |
190 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||| |||||||||||| |
|
|
| T |
43217271 |
ggaggaggagaaagagtatttttagggtttgagggtttgttgcggaaagccaatattcgcgttgggaggttggcggcttccaagagtattttctggtaga |
43217172 |
T |
 |
| Q |
191 |
gttcactccatgctgacgatgaatc |
215 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43217171 |
gttcactccatgctgacgatgaatc |
43217147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University