View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9704_low_14 (Length: 335)

Name: NF9704_low_14
Description: NF9704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9704_low_14
NF9704_low_14
[»] chr3 (1 HSPs)
chr3 (17-160)||(45223700-45223843)
[»] chr4 (1 HSPs)
chr4 (160-237)||(44229712-44229792)
[»] chr1 (1 HSPs)
chr1 (161-234)||(51276398-51276471)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 45223843 - 45223700
Alignment:
17 aggaggccgctacggaagagaacatcgcagtcagtgacgtggcggtggagagtggcgatgagtgaatcgatttggctttgagtttggagtttaccgtggg 116  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45223843 aggaggccgctacggaaaagaacatcgcagtcagtgacgtggcggtggagagtggcgatgagtgaatcgatttggctttgagtttggagtttaccgtggg 45223744  T
117 gtaaaatttgggattgacagtggtgagagagtgaaacggcgtcg 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
45223743 gtaaaatttgggattgacagtggtgagagagtgaaacggcgtcg 45223700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 160 - 237
Target Start/End: Original strand, 44229712 - 44229792
Alignment:
160 ggtgcggtgaggacggtggtggttgtgactgacgaaggcggctgc---ggtggtggtggtcagaaaggagggtgtggttgt 237  Q
    ||||||||||||||||||||||||||||||||||||||||| |||   |||||||||||||||||||||||||||||||||    
44229712 ggtgcggtgaggacggtggtggttgtgactgacgaaggcggttgcggtggtggtggtggtcagaaaggagggtgtggttgt 44229792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 161 - 234
Target Start/End: Original strand, 51276398 - 51276471
Alignment:
161 gtgcggtgaggacggtggtggttgtgactgacgaaggcggctgcggtggtggtggtcagaaaggagggtgtggt 234  Q
    |||||||||||   |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||    
51276398 gtgcggtgaggctagtggtggttgtgactgacgaaggcagttgcggtggtggtggtcagaaaggagggtgtggt 51276471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University