View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9704_low_15 (Length: 330)
Name: NF9704_low_15
Description: NF9704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9704_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 23711980 - 23712191
Alignment:
| Q |
18 |
ggtcaaggtggtcttagttgtagaggtagtcatgaacatggactctttcgtgctgtccaacatggtgacctgaaaactgtttctactcttttacagactc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23711980 |
ggtcaaggtggtcttagttgtagaggtagtcatgaacatggactctttcgtgctgtccaacatggtgacctcaaaactgtttctactcttttacagactc |
23712079 |
T |
|
| Q |
118 |
acccttctcttctcaatcgtactactgtttatgatcatcattcccctcttcatattgctgctgccaatggtcagatccaggttcaattcttttccctttc |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23712080 |
acccttctcttctcaatcgtactaccgtttatgatcatcattcccctcttcatattgctgctgccaatggtcagatccaggttcaattcttttccctttg |
23712179 |
T |
|
| Q |
218 |
agtgttgattcg |
229 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
23712180 |
agtgttaattcg |
23712191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 23712245 - 23712329
Alignment:
| Q |
224 |
gattcgtcttagatggacttattaaccatttgagccaagtttcccaattgggttttcattttaatttctgggtctgaaaaaaaaa |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23712245 |
gattcgtcttagatggacttattaaccatttgagccaagtttcccaattgggttttcattttaatttctgggtctgaaaaaaaaa |
23712329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University