View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9704_low_26 (Length: 251)
Name: NF9704_low_26
Description: NF9704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9704_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 43376250 - 43376027
Alignment:
| Q |
1 |
tctgtgggaaacaaaacaagaaatagactcaaatgtgtttttgagaattctctacgttaatgtaatgcaaaatcgaaacgaataaaatttgnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376250 |
tctgtgggaaacaaaacaagaaatagactcaaatgtgtttttgagaattctctacgttaatgtaatgcaaaatcgaaacgaataaaatttgttttttttt |
43376151 |
T |
|
| Q |
101 |
c--------ctagttgtcaaaaacacgggaatgacactgtttaccttttctttaacttaacgccacgtgttctaaggtaaccacgttgataattgacctt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43376150 |
tttttttttctagttgtcaaaaacacgggaatgacactgtttaccttttctttaacttaacgccacgtgttctaaggtaaccacgttgacaattgacctt |
43376051 |
T |
|
| Q |
193 |
cgaactcaccctaccagatcagat |
216 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43376050 |
cgaactcaccctaccagatcagat |
43376027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University