View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9704_low_28 (Length: 248)
Name: NF9704_low_28
Description: NF9704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9704_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 76 - 240
Target Start/End: Original strand, 11368477 - 11368641
Alignment:
| Q |
76 |
acttgataatttacctcatgttatgatttgtatatacatgatattgaatatttttcgcttgatatttttcacttggcattgtatttaattctgttttacc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11368477 |
acttgataatttacctcatgttatgatttgtatatacatgatattgaatatttttcgcttgatatttttcacttggcattgtatttaattctgttttaac |
11368576 |
T |
|
| Q |
176 |
ttggatttatatgatattgaagatctatgggttaaagcttatccatattaattttgccctttgct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11368577 |
ttggatttatatgatattgaagatctatgggttaaagcttatccatattaattttgccttttgct |
11368641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University