View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9704_low_31 (Length: 241)
Name: NF9704_low_31
Description: NF9704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9704_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 16 - 121
Target Start/End: Original strand, 43170535 - 43170640
Alignment:
| Q |
16 |
ggacatcagttctaccccagtctaataaattcaaggggaaacattccaagatatctgtggcattcaaagttatctcacaactctgcaaaatcattttcac |
115 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43170535 |
ggacaccagttctaccccaatctaataaattcaaggggaaacattccaagatatctgtggcattcaaagttatctcacaactctgcaaaatcattttcac |
43170634 |
T |
 |
| Q |
116 |
aaacac |
121 |
Q |
| |
|
|||||| |
|
|
| T |
43170635 |
aaacac |
43170640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 16 - 121
Target Start/End: Complemental strand, 43217801 - 43217696
Alignment:
| Q |
16 |
ggacatcagttctaccccagtctaataaattcaaggggaaacattccaagatatctgtggcattcaaagttatctcacaactctgcaaaatcattttcac |
115 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43217801 |
ggacaccagttctaccccaatctaataaattcaaggggaaacattccaagatatctgtggcattcaaagttatctcacaactctgcaaaatcattttcac |
43217702 |
T |
 |
| Q |
116 |
aaacac |
121 |
Q |
| |
|
|||||| |
|
|
| T |
43217701 |
aaacac |
43217696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 134 - 233
Target Start/End: Complemental strand, 43217522 - 43217422
Alignment:
| Q |
134 |
aaaattagtccttatggtatgtagaatggacaaa-taaatattacaactacgacatggaccgatttcaacatgaaaaatttttgtagcgaccgaaaaaca |
232 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| || |||||||||||||| |||||| |
|
|
| T |
43217522 |
aaaattagtccttattgtatgtagaatggacaaaataaatattacaactacgacatggaccgatttcaacacgaacaaattttgtagcgaccgtaaaaca |
43217423 |
T |
 |
| Q |
233 |
a |
233 |
Q |
| |
|
| |
|
|
| T |
43217422 |
a |
43217422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University