View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9705_low_12 (Length: 348)
Name: NF9705_low_12
Description: NF9705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9705_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 20 - 126
Target Start/End: Complemental strand, 21044132 - 21044026
Alignment:
| Q |
20 |
tctgtgtcagtgcttcgtaggttctaacgagtaattaaaatttatgtgaaccaggaagaaggttattgggttggatgatcttcttaatgaacactacaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21044132 |
tctgtgtcagtgcttcgtaggttctaacgagtaattaaaatttatgtgaaccaggaagaaggttattgggttggatgatcttcttaatgaacactacaaa |
21044033 |
T |
|
| Q |
120 |
gaacagg |
126 |
Q |
| |
|
||||||| |
|
|
| T |
21044032 |
gaacagg |
21044026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 192 - 262
Target Start/End: Complemental strand, 21043960 - 21043890
Alignment:
| Q |
192 |
tacgatgatgaagatcgtaaggaagctcatttgaataggctagttgagaaatgtcacaatcaggtataata |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21043960 |
tacgatgatgaagatcgtaaggaagctcatttgaataggctagttgagaaatgtcacaatcaggtataata |
21043890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University