View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9705_low_15 (Length: 309)
Name: NF9705_low_15
Description: NF9705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9705_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 16 - 292
Target Start/End: Complemental strand, 26669244 - 26668968
Alignment:
| Q |
16 |
acatcagtcggaacattaaaaccctcttttcctaacctctcaatcaacacttccggaataccgagttccgaaaaagacttagcagcaaaaggggcattct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26669244 |
acatcagtcggaacattaaaaccctcttttcctaacctctcaatcaacacttccggaataccgagttccgaaaacgacttagcagcaaaaggggcattct |
26669145 |
T |
|
| Q |
116 |
ctatttcttttctctctttaaccctaacacttttcttctcactaattccaaagggttttcttttcaccttgaaaccctcagaagaagataaacctaacgg |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26669144 |
ctatttcttttctctctttaatcctaacacttttcttctcactaattccaaagggttttcttttcaccttgaaaccctcagaagaagataaacctaacgg |
26669045 |
T |
|
| Q |
216 |
cttaaccttgttttcttcacttgtaatctttggctcaatttcactttcaaaaccaacgcttgaaagggtcaaagaat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26669044 |
cttaaccttgttttcttcacttgtaatctttggctcaatttcactttcaaaaccaacgcttgaaagggtcaaagaat |
26668968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University