View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9705_low_18 (Length: 277)
Name: NF9705_low_18
Description: NF9705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9705_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 139 - 265
Target Start/End: Complemental strand, 54229303 - 54229177
Alignment:
| Q |
139 |
gcagtggttgctttgatgagtattaaagaagcactaaatgatccacacaatgtattaagcaactgggatgaattctctgttgacccttgtagttgggcta |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54229303 |
gcagtggttgctttgatgagtattaaagaagcactaaatgatccacacaatgtattaagcaactgggatgaattctctgttgacccttgtagttgggcta |
54229204 |
T |
|
| Q |
239 |
tgattacttgctcttctgattcctttg |
265 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
54229203 |
tgattacttgctcttctgattcctttg |
54229177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 54229456 - 54229386
Alignment:
| Q |
1 |
tcttcttattcctctcccaccaacctttctcttccgcttcagagcctcgcaaccccgaaggtactacttgc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54229456 |
tcttcttattcctctcccaccaacctttctcttccgcttcagagcctcgcaaccccgaaggtactacttgc |
54229386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University