View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9705_low_28 (Length: 228)
Name: NF9705_low_28
Description: NF9705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9705_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 37022461 - 37022240
Alignment:
| Q |
7 |
agttgggcttgatgtcgcatgcaaactcagaagaattttgatggataacacacctttatatccccacaaaccagttatgagtgtaagtttatattttgtt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37022461 |
agttgggcttgatgtcgcatgcaaactcagaagaattttgatggataacacacctatatatccccacaaaccagttatgagtgtaagtttatattttgtt |
37022362 |
T |
|
| Q |
107 |
gggctgaaaattggtgcgaaagccnnnnnnnnntacacattctgtatggtagattgggcaagtctttcccacccgattagtcgttcactgatgagtataa |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37022361 |
gggctgaaaattggtgcgaaagccaaaaaaaaatacacattctgtatggtagattgggcaagtctttcccacccgattagtcgttcactgatgagtataa |
37022262 |
T |
|
| Q |
207 |
catcttcataattgtaacattt |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37022261 |
catcttcataattgtaacattt |
37022240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University