View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9705_low_31 (Length: 224)
Name: NF9705_low_31
Description: NF9705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9705_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 35015341 - 35015150
Alignment:
| Q |
16 |
tacaatttaggaagatgaatttataatgaaatcgcaagcagtgaattgttcatagtgatccaaaatgtgcaaacaaaatttagtatatgagtcaaaaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
35015341 |
tacaatttaggaagatgaatttataatgaaatcgcaagcagtgaattgttcataatgacccaaaatgtgcaaacaaaatttagaatatgagtcaaatttt |
35015242 |
T |
|
| Q |
116 |
ttaagtaagattgaaatgaagaat-ctaatttgggtgaaatttttaatgtaacatatatttttgaacggatgtaatattcaatgtaaaatat |
206 |
Q |
| |
|
|||||||| |||| |||||| ||| ||||||| ||||||| |||||| ||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35015241 |
ttaagtaaaattgcaatgaaaaatcctaattttggtgaaaattttaaagtaacatatatttttgaacagatgtaatatttaatgtaaaatat |
35015150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University