View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_high_24 (Length: 307)
Name: NF9706_high_24
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_high_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 307
Target Start/End: Original strand, 26754346 - 26754634
Alignment:
| Q |
19 |
ccctgcacacctcttgcttaatcctggaacttcgatcatgaagatttgtccatatacatattgttctctcaatggcaatcgacatgctcctttgcctcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26754346 |
ccctgcacacctcttgcttaatcctggaacttcgatcatgaagatttgtccatctacatattgttctctcaatggcaatcaacatgctcctttgcctcaa |
26754445 |
T |
 |
| Q |
119 |
tttaattgcatcatgtcagcaaagaatgaccttttgaagactcggaagactataaagatggaagtgcctcaaagactgaaggtgccttgtgagataagga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26754446 |
tttaattgcatcatgtcagcaaagaatgaccttttgaagactcggaagagtataaagatggaagtgcctcgaagactgaaggtgccttgtgagataagga |
26754545 |
T |
 |
| Q |
219 |
aggattttgatattgagcagattgtctttaatgaagttgatgccatggaaagggaaaaggcatacgaaataggaagatcggacactgtc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26754546 |
aggattttgatattgagcagattgtctttgatgaagttgatgccatggaaagggaaaaggcatacgaaatgggaagatcggacactgtc |
26754634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University