View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_high_31 (Length: 278)
Name: NF9706_high_31
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 52490759 - 52490501
Alignment:
| Q |
1 |
agaagcacaaggtggcaagtgacaaagaggtccagaatcaaaactcatagannnnnnnnnnnnnnnnnnnnnnnngaagtatgatgtgaggtgaagcatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52490759 |
agaagcacaaggtggcaagtgacaaagaggtccagaatcaaaactcatagattttttattttatttttgatttttgaagtatgatgtgaggtgaagcatc |
52490660 |
T |
 |
| Q |
101 |
catatccatatatgaatgaaggaaatatatgatacagaacattcatactatcaattttacattatatattgcctttgacaacatggctaatttttgcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52490659 |
catatccatatatgaatgaaggaaatatatgatacagaacattcatactatcaattttacattatatattgcctttgacaacatggctaatttttgcatt |
52490560 |
T |
 |
| Q |
201 |
aattttgtcttttgccgacaccctttcttgtctgctacatgtaattgatgattgattga |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52490559 |
aattttgtcttttgccgacaccctttcttgtctgctacatgtaattgatgattgattga |
52490501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University