View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_high_40 (Length: 224)
Name: NF9706_high_40
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_high_40 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 24506836 - 24506597
Alignment:
| Q |
1 |
caagtatttcgttggggacgaccaagttttagcaatgcagctgtccgaacgaacatctctaccaaaacgaaggaaataatttccctttagacattgatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24506836 |
caagtatttcgttggggacgaccaagttttagcaatgcagctgtccgaacgaacatctctaccaaaacgaaggaagtaatttccctttagacattgatga |
24506737 |
T |
 |
| Q |
101 |
atcgaccgaggatgtcgctgatgttctcatttctcaatgtcaaatgtatgaacaagtaggtcttgt----------------atggactatttgggtttc |
184 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
24506736 |
atcgactgaggatgtcgctgatgttctcatttctcaatgtcaaatttatgaacaagtaggtcttttgttgaatgacatgtcgatggactatttgggtttc |
24506637 |
T |
 |
| Q |
185 |
agggagcagtttcaacatgctttgaataacctttctctct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24506636 |
agggagcagtttcaacatgctttgaataacctttctctct |
24506597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University