View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_high_41 (Length: 220)
Name: NF9706_high_41
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 40 - 202
Target Start/End: Original strand, 39492442 - 39492604
Alignment:
| Q |
40 |
tatacgacgcgaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39492442 |
tatacgacgcgaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtg |
39492541 |
T |
 |
| Q |
140 |
cttcccttccaattgctgttcctattatcaaagaaattgatttgtataagtttgatccatggc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39492542 |
cttcccttccaattgctgttcctattatcaaagaaattgatttgtataagtttgatccatggc |
39492604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 50 - 202
Target Start/End: Original strand, 44370809 - 44370961
Alignment:
| Q |
50 |
gaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtgcttcccttcc |
149 |
Q |
| |
|
|||||||||| | |||||| ||||||||||| ||||||||||||||||||||||| || | |||||||||||||||||| | || |||||| | | |
|
|
| T |
44370809 |
gaatgcaaggtgaattagaattaccacctggtttcagatttcaccctactgatgaagaattggtgaatcactacttgtgtcgcaaatgtgctggtcaatc |
44370908 |
T |
 |
| Q |
150 |
aattgctgttcctattatcaaagaaattgatttgtataagtttgatccatggc |
202 |
Q |
| |
|
||| ||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44370909 |
tatttctgttcccgttgtcaaagaagttgatttgtataagtttgatccatggc |
44370961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University