View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_low_17 (Length: 412)
Name: NF9706_low_17
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 133 - 356
Target Start/End: Original strand, 7763649 - 7763872
Alignment:
| Q |
133 |
tgattttgggtcaaaatccgacaaatcaagatgaagaagaaaaatagtgacggctaggtttgagaagctcacaaacaacattattaggagtaaccaacac |
232 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
7763649 |
tgattttgggtcaaaattcgacagatcaagatgaagaagaaaaatagtgacggctaggtttgagaagctcacaaacaacattattaagagtaatcaacac |
7763748 |
T |
|
| Q |
233 |
agtaattactgaattaattgtttctcggaaaaatgatccatcggcttcgattgtcgaaaaagaagatgtaacattgtaaaggaccaaaataaattttcac |
332 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
7763749 |
aataattattgaattaattgtttctcggaaaaatgatccatcggcttcgattgtcggaaaagaagatgcaacattgtgaatgaccaaaataaattttcac |
7763848 |
T |
|
| Q |
333 |
cttaaaataaatggacttgattta |
356 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7763849 |
cttaaaataaatggacttgattta |
7763872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 40702580 - 40702546
Alignment:
| Q |
19 |
tcaaaacaaatagagtcgtgcaaagacgatgaaat |
53 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
40702580 |
tcaaaacaaatagaatcgtgcaaagacgatgaaat |
40702546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University