View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_low_19 (Length: 385)
Name: NF9706_low_19
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 19 - 372
Target Start/End: Original strand, 45305810 - 45306161
Alignment:
| Q |
19 |
catactgataaagaactgattactaataaggaggaagaaattcatacaatgtttatgacatatttatataacattgtctctgtaagagaggtttagtgga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45305810 |
catactgataaagaactgattactaataaggaggaagaaattcatacaatgtttatgacatatttatg--acattgtctctgtaagagaggtttagtgga |
45305907 |
T |
 |
| Q |
119 |
agcatatgtttcaggaagctggtcaaatcattgacgttttgttcaaatatcatcttcatttatagagtcattttaaagattttgatgttgtttagaattg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45305908 |
agcatatgtttcaggaagctggtcaaatcattgacgttttgttcaaatatcatcttcatttatagagtcattttaaagattttgatgttgtttagaattg |
45306007 |
T |
 |
| Q |
219 |
cattgttgctctttaattttannnnnnnnaaatatatcaaatatagactttgctttccaaagtcttcaactctaaaatcctccaaaacccaactcgaaaa |
318 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45306008 |
cattgttgctctttaattttattttttttaaatatatcaaatatagactttactttccaaagtcttcaactctaaaatcctccaaaacccaactcgaaaa |
45306107 |
T |
 |
| Q |
319 |
caaaaacttttgagatcnnnnnnnatttgttttgagattttggctccctttgct |
372 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45306108 |
caaaaacttttgagatctttttttatttgttttgagattttggctccctttgct |
45306161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University