View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_low_24 (Length: 341)
Name: NF9706_low_24
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 13 - 329
Target Start/End: Original strand, 26754605 - 26754921
Alignment:
| Q |
13 |
gcataggaaataggaagatcggacactgtcaaacaccttgaggatctagaaggtgtcaagtttgcaatggaggggaatggcaacatagcagatgagaaat |
112 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26754605 |
gcatacgaaatgggaagatcggacactgtcaaacaccttgaggatccagaaggtgtcaagtttgcaatggaggggaatggcaacatagcagatgagaaat |
26754704 |
T |
 |
| Q |
113 |
gtgtctatcatgtaactccatgtttgccttgtggtgatctcaccaagtctgagattaatcccaaggtggaattcaaaaactactttgacatttctgaaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26754705 |
gtgtctatcatgtaactccatgtttgccttgtggtgatctcaccaagtctgagatgaatcccaaggtggaattcaaaaactactttgacatttctgaaat |
26754804 |
T |
 |
| Q |
213 |
tgaagcagataccgaggaaagcattcaccaagaaccaaaggctaaagatacggacaaaaaccaccaacctaactggtttcatgaagaaatatgtacagga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26754805 |
tgaagcagataccgaggaaagcattcaccaagaaccaaaggctatagatacggacaaaaaccaccaacctaactggtttcatgaagaaatatgtacagga |
26754904 |
T |
 |
| Q |
313 |
agctgctgtggtgatgt |
329 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
26754905 |
agctactgtggtgatgt |
26754921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University