View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_low_32 (Length: 298)
Name: NF9706_low_32
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 6 - 275
Target Start/End: Original strand, 45144031 - 45144300
Alignment:
| Q |
6 |
agcagcacagatataatatcccttcacaaacactctcggcggaatcaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatc |
105 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144031 |
agcaccaccgatataatatcccttcacaaacactctcggcggaaccaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatc |
45144130 |
T |
 |
| Q |
106 |
gaaacgtcacgctcgcatatttgtacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144131 |
gaaacgtcacgctcgcatatttgtacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttg |
45144230 |
T |
 |
| Q |
206 |
tatagatcaccactttcttctctccgtttggtggacatatcctctcaaaccgatccgaaagcgtcgaacc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45144231 |
tatagatcaccactttcttctctccgtttggtggacatatcctctcaaaccgatccgaaagcgtccaacc |
45144300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University