View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_low_41 (Length: 250)
Name: NF9706_low_41
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 2243930 - 2243739
Alignment:
| Q |
1 |
ctttctacataaatttactaccacatgtaactgggaaattattctaaacagtggcctttttgtttaaacttggtgttacttatttcctttctttgttccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2243930 |
ctttctacataaatttactaccacatgtaactgggaaattattctaaacagtggcctttttgtttaaacttggtgttacttatttcctttctttgttccg |
2243831 |
T |
 |
| Q |
101 |
tgtgtcaggttagaaaaggataggaattataactactttttggtgcgctgtttaaaactgttatgtgtaagtactttctaattatacagtga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2243830 |
tgtgtcaggttagaaaaggataggaattataactactttttggtgcgctgtttaaaactgttatgtgtaagtactttctaattatacagtga |
2243739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 209 - 240
Target Start/End: Complemental strand, 2243722 - 2243691
Alignment:
| Q |
209 |
gcaaagttatggcttataatatactacctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2243722 |
gcaaagttatggcttataatatactacctatg |
2243691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University