View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_low_42 (Length: 249)
Name: NF9706_low_42
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 236
Target Start/End: Original strand, 5789273 - 5789502
Alignment:
| Q |
7 |
ggagcagagacaatcagatgcttgcagaaggtgataggatccttggcattgggcttggctagccttgtttttatgttctagagaagagatttccttgtta |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5789273 |
ggagcagaaacaatcagatgcttgcagaaggtgataggatccttggcattgggcttggctagccttgtttttatgttctagagaagagatttccttgtta |
5789372 |
T |
 |
| Q |
107 |
ttgttaccacgatatattcatatgtatcatttattttcnnnnnnnggtcctgtcttgggctaacattaaatttatttgccattgnnnnnnnaaactctta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5789373 |
ttgttaccacgatatattcatatgtatcatttattttctttttttggtcctgtcttgggctaacattaaatttatttgccattgtttttttaaactctta |
5789472 |
T |
 |
| Q |
207 |
ttattctattacatattggtgatgtttttg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5789473 |
ttattctattacatattggtgatgtttttg |
5789502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University