View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_low_49 (Length: 239)
Name: NF9706_low_49
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 9 - 214
Target Start/End: Original strand, 34572689 - 34572895
Alignment:
| Q |
9 |
agaagcagagacattgggataacaataaaatgcctcatgcacattcactttgttaaagtttcagttcacatgtgatgttaatgtagaacaagttcacata |
108 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572689 |
agaaacagtgacattgggacaacaataaaatgcctcatgcatattcactttgttaaagtttcagttcacatgtgatgttaatgtagaacaagttcacata |
34572788 |
T |
 |
| Q |
109 |
tgttagttcctttgctagcaatgtgggact-aaaacactttttactttctttctactcctcacacctcacttgccactcacttgtaataatattacttgc |
207 |
Q |
| |
|
||||| |||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572789 |
tgttaattcctttggtggcaatgtgggactaaaaacactttttactttctttctactcctcacacctcacttgccactcacttgtaataatattacttgc |
34572888 |
T |
 |
| Q |
208 |
agttcca |
214 |
Q |
| |
|
||||||| |
|
|
| T |
34572889 |
agttcca |
34572895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 196
Target Start/End: Original strand, 34583329 - 34583358
Alignment:
| Q |
167 |
tcacacctcacttgccactcacttgtaata |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34583329 |
tcacacctcacttgccactcacttgtaata |
34583358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University