View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9706_low_53 (Length: 212)
Name: NF9706_low_53
Description: NF9706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9706_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 10 - 193
Target Start/End: Original strand, 9884068 - 9884251
Alignment:
| Q |
10 |
agaagcaaaggcagacgaaaaaagagctgttgaggagatgaagttgttgtctgacgcacaaggtagtgtctccgtttctgattccagtggtaagatcgtg |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9884068 |
agaagcaaaagcagacgaaaaaagagctgttgaggagatgaagttgttgtctgacgcacaaggtagtgtctccgtttctgattccagtggtaagatcgtg |
9884167 |
T |
 |
| Q |
110 |
ttgacagttgatgaatttgctgctctaagtggaaaaatcaatgaatgtgaagatttgattgagaggacagaaacaactgcaatg |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9884168 |
ttgacagttaatgaatttgctgctctaagtggaaaaatcaatgaatgtgaagatttgattgagaggacagaaacaactgcaatg |
9884251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University