View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9707_low_13 (Length: 236)
Name: NF9707_low_13
Description: NF9707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9707_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 26608926 - 26608702
Alignment:
| Q |
1 |
aaaaaagaaatcagtttcaacgcacgtaactaaaatggacaagaaccaatgctttatacaaaaattcatataatataattcta-----aaccgatgggac |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
26608926 |
aaaaaagaaatcagtttcaacgcacgtaactaaaatggacaagaaccaatgctttatacaaaaattcatataatataattttattttaaaccgatgggac |
26608827 |
T |
 |
| Q |
96 |
attgcttaatctttcgatatattagttattcccctcctctattcttcttataaagttgtagatatttttggaggttgaatttgatctagatatggttcga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608826 |
attgcttaatctttcgatatattagttattcccctcctctattcttcttataaagttgtagatatttttggaggttgaatttgatctagatatggttcga |
26608727 |
T |
 |
| Q |
196 |
gattctttattacatcagacctagc |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26608726 |
gattctttattacatcagacctagc |
26608702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 213
Target Start/End: Complemental strand, 26595190 - 26595161
Alignment:
| Q |
184 |
gatatggttcgagattctttattacatcag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26595190 |
gatatggttcgagattctttattacatcag |
26595161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University