View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9707_low_15 (Length: 222)
Name: NF9707_low_15
Description: NF9707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9707_low_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 6948803 - 6949025
Alignment:
| Q |
1 |
gaaagcattgatattgtcgagttccattatgtgtatgtttggattgacgatgagattgacaaaatcataatgccaccgtagttttgtgagattacaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6948803 |
gaaagcattgatattgtcgagttccattatgtgtatgtttggattgacgatgagattgacaaaatcataatgccaccgtagttttgtgagattacaaaat |
6948902 |
T |
|
| Q |
101 |
gtagtttttagcaaaatcattgtggctcaacttatattcactcaatctcgcctttaatcaaaacgt-cacttcactgtaatgttataacaaagtgtctac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6948903 |
gtagtttttagcaaaatcattgtggctcaacttatattcactcaatctcacctttaatcaaaacgtacacttcactgtaatgttataacaaagtgtctac |
6949002 |
T |
|
| Q |
200 |
tccagaaaagatataaataataa |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6949003 |
tccagaaaagatataaataataa |
6949025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 34 - 67
Target Start/End: Complemental strand, 28007961 - 28007928
Alignment:
| Q |
34 |
tatgtttggattgacgatgagattgacaaaatca |
67 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
28007961 |
tatgtttagattgacgatgagattgacaaaatca |
28007928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University