View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9707_low_9 (Length: 325)
Name: NF9707_low_9
Description: NF9707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9707_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 5 - 295
Target Start/End: Complemental strand, 43984149 - 43983859
Alignment:
| Q |
5 |
gtggagaagcagagaagagtaggagtccaagagaattgagtgatatctgcataagatgccgtgtctgattttgctacatcttttttggtttagcacgata |
104 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43984149 |
gtggaggagaagagaagagtaggagtccaagagaattgagtgatatctgcataagatgccgtgtctgattttgctacatcttttttggtttagcacgata |
43984050 |
T |
|
| Q |
105 |
ttggtaagaaattttcaccgcttagcagtaattaatttcgttgggaaatatgtgagagtcaataattaaactctgaaccttaggtttaaggagctcaaat |
204 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
43984049 |
ttggtacgaaattttcaccgcttagcagtaattaatttcgttgggaaatatgtgagagtcaataattaaactctgaaccttatgtttaaggagcttaaat |
43983950 |
T |
|
| Q |
205 |
ctcttattacttggattaattatacttttgtatttggcattgtttatgtttaataaaagtcattttattttggatcaattgaaggattgta |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43983949 |
ctcttattacttggatcaattatacttttgtatttggcattgtttatgtttaataaaagtcattttattttggatcaattgaaggattgta |
43983859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University