View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9708_low_17 (Length: 266)
Name: NF9708_low_17
Description: NF9708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9708_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 35637223 - 35637465
Alignment:
| Q |
19 |
ctccctataatggatccccatgtgaccattttcacccaaaagattggtatatgaattagtagtgaattgtattatgaccattgtatttcatctttaagga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35637223 |
ctccctataatggatccccatgtgaccattttcacccaaaagattggtatatgaattagtagtgaattgtattatgaccattgtatttcatcattaagga |
35637322 |
T |
 |
| Q |
119 |
accattactgccttaaacacaaat-----acattaaatatgtagtatgaacactagcaaagcaacatgcaaaaggtacaaggccagcatatatggtacta |
213 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35637323 |
accattactgccctaaacacaaattaaatacattaaatatgtagtatgaacactagcaaagcaacatgcaaaaggtacaaggccagcatatatggtacta |
35637422 |
T |
 |
| Q |
214 |
cggaaaatcagatctgtcattattttttaataaggtccctttg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35637423 |
cggaaaatcagatctgtcattattttttaataaggtccctttg |
35637465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University