View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9708_low_20 (Length: 251)
Name: NF9708_low_20
Description: NF9708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9708_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 213
Target Start/End: Original strand, 23145542 - 23145752
Alignment:
| Q |
3 |
tctctactgctatacctctgtgatgtggatcgattttcggtgttagctttagcctgcgtgtgtaagcagatcatgttctgttgtggccagtcttctgcat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23145542 |
tctctactgctatacctctgtgatgtggatcgattttcggtgttagccttagcctgcgtgtgtaagcagatcatgttctgttgtggccagtcttctgcat |
23145641 |
T |
 |
| Q |
103 |
tcagcaggtggtttcgagctaggcagtgtgattttggactgtggcggtgttttggagcatctttgggcctttgatatcttaggttttttgtctgagatgt |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23145642 |
tcagcaggtggtttcgagttaggcagtgtgattttggactgtggcggtgttttggagcatctttgggcctttgatatcttaggttttttggctgagatgt |
23145741 |
T |
 |
| Q |
203 |
tagtttgggtg |
213 |
Q |
| |
|
|||||| |||| |
|
|
| T |
23145742 |
tagttttggtg |
23145752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University