View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9708_low_23 (Length: 250)
Name: NF9708_low_23
Description: NF9708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9708_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 5906869 - 5906754
Alignment:
| Q |
1 |
tagcctcgattttgatcgtgagaaaaacagcgaaacctttatcaattccatgaaaataattggtgccaaaaatatgtcaacactcataacaaaccttgcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5906869 |
tagcctcgattttgatcgtgagaaaaacagtgaaacctttatcaattccatgaaaacaattggtgccaaaaatatgtcaacactcataacaaaccttgcc |
5906770 |
T |
|
| Q |
101 |
aaagtacgtgactatt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5906769 |
aaagtacgtgactatt |
5906754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University