View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9709_low_14 (Length: 250)
Name: NF9709_low_14
Description: NF9709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9709_low_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 25 - 250
Target Start/End: Complemental strand, 33117715 - 33117490
Alignment:
| Q |
25 |
ctattagaattttgttatcggactaccaactatttatatctacacgctaaactcaataatgatggacgtgaaagagtgttaaaaagtctcgcattgaatt |
124 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| | || |||| |||| |
|
|
| T |
33117715 |
ctattaggatttcgttatcggactaccaactatttatatctacacactaaactcaataatgatggacgtgaaagagtattaaaaaatttcacattaaatt |
33117616 |
T |
 |
| Q |
125 |
agatataacttaaatatgtgtttataaataggtgcaatctcactttacaagttggttttatagatttgtattaaactaaaccacgtattctaatagttgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| || ||||||||||| ||||||| ||||||||||||| | |
|
|
| T |
33117615 |
agatataacttaaatatgtgtttataaataggtgcaatctcactttacaaattagttttatggagttgtattaaaccaaaccacttattctaatagttct |
33117516 |
T |
 |
| Q |
225 |
atttcaatcttgattgattccttttc |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33117515 |
atttcaatcttgattgattccttttc |
33117490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University