View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9709_low_15 (Length: 249)
Name: NF9709_low_15
Description: NF9709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9709_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 53060189 - 53060390
Alignment:
| Q |
1 |
ctcaaacataactccacacatgcgccatcatttatagggtcaaaacacccccacatttttagcacatgtaggttgtcaattatctgttcgacgcaatttt |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53060189 |
ctcaaacataacaccacacatgcgccatcctttatagggtcaaaacgcccccacttttttagcacatgtaggttgtcaagtatctgttcgacgcaatttt |
53060288 |
T |
|
| Q |
101 |
gaaatatttttctctgggtttctatcctcttacaagtggtcaagtatctggtgacgtcgtgtctgcattgcataattttggacagaatagtgaaacttag |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53060289 |
gagatatttttctctgggtttctatcctcttataagtggtcaagtatctggtgacgtcgtgtctgcattgtataattttggacagaatagtgaaacttag |
53060388 |
T |
|
| Q |
201 |
cg |
202 |
Q |
| |
|
|| |
|
|
| T |
53060389 |
cg |
53060390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University