View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9709_low_17 (Length: 246)
Name: NF9709_low_17
Description: NF9709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9709_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 5375584 - 5375814
Alignment:
| Q |
1 |
cattctaacagcaggtcagttactttcttagcatatagtgccgccgagaactttttaatatctggatctgatgatggaatagttcgagtttggaatgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5375584 |
cattctaacagcaggtcagttactttcttagcatatagtgccgctgagaactttttaatatctggatctgatgatggaatagttcgagtttggaatgcca |
5375683 |
T |
|
| Q |
101 |
gtgctcataacatcttcaactcttattgctttagttatatcagttatcatctcagtgcagttggcactgacagtgtattcatcatatattcaactcttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5375684 |
gtgctcataacatcttcaactcttattgctttagttatatcagttatcatctcagtgcagttggcactgacagtgtattcatcatatattcaactcttgt |
5375783 |
T |
|
| Q |
201 |
taatacttctactgctactgctagtgtatac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5375784 |
taatacttctactgctactgctagtgtatac |
5375814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 5369398 - 5369285
Alignment:
| Q |
1 |
cattctaacagcaggtcagttactttcttagcatatagtgccgccgagaactttttaatatctggatctgatgatggaatagttcgagtttggaatgcca |
100 |
Q |
| |
|
|||||| |||||| | ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5369398 |
cattcttacagcaaggcagttacttgcttagcatatagtgccgccgagaattttttaatatctggatctgatgatggaattgttcgagtttggaatgcca |
5369299 |
T |
|
| Q |
101 |
gtgctcataacatc |
114 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
5369298 |
gtactcataacatc |
5369285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 178
Target Start/End: Complemental strand, 5368918 - 5368889
Alignment:
| Q |
149 |
atctcagtgcagttggcactgacagtgtat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5368918 |
atctcagtgcagttggcactgacagtgtat |
5368889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University