View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9709_low_23 (Length: 207)
Name: NF9709_low_23
Description: NF9709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9709_low_23 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 85 - 207
Target Start/End: Original strand, 33117205 - 33117335
Alignment:
| Q |
85 |
ggattaccagcttaaaaaataagtggaatgaatatccacattgtgaatataaaattatgctactcaacatttggtaaattagagc--------tttcaca |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33117205 |
ggattaccagcttaaaaaataagtggaatgaatatccacattgtgaatataaaattatgctactcaacatttggtaaattagagctttcactgtttcaca |
33117304 |
T |
|
| Q |
177 |
tctcaaatatctaatcgttttgtctttttgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33117305 |
tctcaaatatctaatcgttttgtctttttgt |
33117335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 46
Target Start/End: Original strand, 33117131 - 33117163
Alignment:
| Q |
14 |
gtttatgactattttcttaggatctgcattaat |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33117131 |
gtttatgactattttcttaggatctgcattaat |
33117163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University