View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9710_low_10 (Length: 243)
Name: NF9710_low_10
Description: NF9710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9710_low_10 |
 | |
|
| [»] scaffold1121 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 6485232 - 6485460
Alignment:
| Q |
1 |
tttagggttaaattatcgtatcctttaaatcaccgtaagtatatttagggttaaattatcgtatccattaaatcaccgtaagtatacagttggatcacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485232 |
tttagggttaaattatcgtatcctttaaatcaccgtaagtatatttagggttaaattattgtatccattaaatcaccgtaagtatacagttggatcacct |
6485331 |
T |
|
| Q |
101 |
ttaaagcaagcaaatgtgtttgtacataaggaaaagttattcccacttgattttgactaaaaacccaatcttcacaattttaaactaaagatagaagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6485332 |
ttaaagcaagcaaatgtgtttgtacataaggaaaagttattcccacttgattttgactaaaaacccaatcttcacaattttaaactaaagat-gaagttg |
6485430 |
T |
|
| Q |
201 |
tttttagttataggtttgtgttttgatgat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6485431 |
tttttagttataggtttgtgttttgatgat |
6485460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 232
Target Start/End: Complemental strand, 21592654 - 21592624
Alignment:
| Q |
202 |
ttttagttataggtttgtgttttgatgatgt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21592654 |
ttttagttataggtttgtgttttgatgatgt |
21592624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 194 - 232
Target Start/End: Original strand, 22739939 - 22739977
Alignment:
| Q |
194 |
gaagttgtttttagttataggtttgtgttttgatgatgt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22739939 |
gaagttgtttttagttataggtttgtgttttgatgatgt |
22739977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 233
Target Start/End: Complemental strand, 42369965 - 42369934
Alignment:
| Q |
202 |
ttttagttataggtttgtgttttgatgatgtc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42369965 |
ttttagttataggtttgtgttttgatgatgtc |
42369934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1121 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1121
Description:
Target: scaffold1121; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 233
Target Start/End: Original strand, 379 - 409
Alignment:
| Q |
203 |
tttagttataggtttgtgttttgatgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
379 |
tttagttataggtttgtgttttgatgatgtc |
409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 233
Target Start/End: Original strand, 10491357 - 10491387
Alignment:
| Q |
203 |
tttagttataggtttgtgttttgatgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10491357 |
tttagttataggtttgtgttttgatgatgtc |
10491387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University