View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_high_15 (Length: 289)
Name: NF9711_high_15
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 27816325 - 27816592
Alignment:
| Q |
18 |
gagaatgtgtgggctcatggcagggtcggaggagttattgattatgatttgtgattgggatttgggcttgtttttggagccaggtggacggcctcttggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27816325 |
gagaatgtgtgggctcatggcagggtcggaggagtgattgattatgatttgtgattgggctttaggcttgtttttggagccaggtggacggcctcttggc |
27816424 |
T |
 |
| Q |
118 |
ctacgaccaatttcaatggtggcgccgtcgttacaggaaggtttatttgggctgggcccaccgctgcttcgggtttcatcttcttctgaggtttggcatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27816425 |
ctacgaccaatttcaatggtggcgccgtcgttacaggaaggtttgtttgggctgggcccaccgctgcttcgggtttcatcttcttctgaggtttggcatt |
27816524 |
T |
 |
| Q |
218 |
cacgtgaaggttgaaataggttatga------tgttgttgaaagtttgaaaacatttttggtcctttg |
279 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27816525 |
cacgtgaaggttgaaataggttatgatgttgttgttgttgaaagtttgagaacatttttggtcctttg |
27816592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University