View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_high_21 (Length: 252)
Name: NF9711_high_21
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_high_21 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 252
Target Start/End: Complemental strand, 41351962 - 41351723
Alignment:
| Q |
13 |
caaagggctaatgtgcattgtgcacacatttggtgaccacaattctgaacttcaattgtgcatacctgctcaaagcagatgcaacataattctgactcac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41351962 |
caaagggctaatgtgcattgtgcacacatttggtgaccacaattctgaacttcaattgtgcatacctgctcaaagcagatgcaacataattctgactcac |
41351863 |
T |
|
| Q |
113 |
taacctgcataatatcatattccacaatgagaatgctatttcttttttggatcacatttataatgcaaattttaaacttggccaaataatcatctttcag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41351862 |
taacctgcataatatcatattccacaatgagaatgctatttcttttttggatcacatttataatgcaaattttaaacttggccaaataatcatctttcag |
41351763 |
T |
|
| Q |
213 |
cctttgattgaaacaaatgataaattcagatagcatcaca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41351762 |
cctttgattgaaacaaatgataaattcagatagcatcaca |
41351723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 24 - 119
Target Start/End: Complemental strand, 23714941 - 23714846
Alignment:
| Q |
24 |
tgtgcattgtgcacacatttggtgaccacaattctgaacttcaattgtgcatacctgctcaaagcagatgcaacataattctgactcactaacctg |
119 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| | || || |||||||| || |||||||||||||||||||| |||||||| | ||| |||||||| |
|
|
| T |
23714941 |
tgtgcattgtgcacacatctggtggccacagtcttggacctcaattgtacacacctgctcaaagcagatgcagcataattccgtctcgctaacctg |
23714846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 204 - 252
Target Start/End: Complemental strand, 36228910 - 36228862
Alignment:
| Q |
204 |
atctttcagcctttgattgaaacaaatgataaattcagatagcatcaca |
252 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
36228910 |
atctctcagcctttgatcgaaacaaatgataaatttagatagcatcaca |
36228862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University