View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_high_27 (Length: 245)
Name: NF9711_high_27
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 16548795 - 16549012
Alignment:
| Q |
18 |
atctcaaggcttaaaaatgagatcttgaacactgaaggtgttaagaatttggtttcttctgatgaaggttatcttcttgagctagccatggtagagaagc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
16548795 |
atctcaaggcttaaaaatgagatcttgaacactgaaggtgttaagaatttggtttcttctgatgaaggttatcttcttgagcttgctatggtagagaagc |
16548894 |
T |
|
| Q |
118 |
ttgaagagttgaaccgtgttgctagtgttgtttctaggttaggtaagaagtgttctgagcctgctttgcaagggtttgagcatgtttatagtgacattgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16548895 |
ttgaagagttgaaccgtgttgctagtgttgtttctaggttaggtaagaagtgttctgagcctgctttgcaagggtttgagcatgtttatagtgacattgt |
16548994 |
T |
|
| Q |
218 |
tggtggtgttattgatgt |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
16548995 |
tggtggtgttattgatgt |
16549012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 111 - 235
Target Start/End: Complemental strand, 32820365 - 32820241
Alignment:
| Q |
111 |
gagaagcttgaagagttgaaccgtgttgctagtgttgtttctaggttaggtaagaagtgttctgagcctgctttgcaagggtttgagcatgtttatagtg |
210 |
Q |
| |
|
|||||||| || || ||||||||||||||| |||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
32820365 |
gagaagctcgaggaattgaaccgtgttgctggtgtggtttctaggttagggaagaagtgttctgtgcctgctttgcaagggtttgagcatgtctatggtg |
32820266 |
T |
|
| Q |
211 |
acattgttggtggtgttattgatgt |
235 |
Q |
| |
|
| |||||| |||||||||| ||||| |
|
|
| T |
32820265 |
atattgttagtggtgttatagatgt |
32820241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University