View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_high_28 (Length: 242)
Name: NF9711_high_28
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 2504848 - 2505078
Alignment:
| Q |
1 |
tagtcttctacttttgattcttatatatcgtcttttcatatattgcatacatttgatgaaacattctctgatgcaatattgttcaaactctgcagatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2504848 |
tagtcttctacttttgattcttatatatcgtcttttcatatattgcatacatttgatgaaccattctctgatgcaatattgttcaaactctgcagatcat |
2504947 |
T |
 |
| Q |
101 |
tccaatggaaccatgcggtgtagggtactggattatctcatcagttcaagtaccactagctgtggttttcactgcttggatggtattaagaaaagaaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2504948 |
tccaatggaaccatgcggtgtaggatactggattatctcatcagttcaagtaccactagctgtggttttcactgcttggatggtattaagaaaagaaagt |
2505047 |
T |
 |
| Q |
201 |
attcaagaccagactctcataccacaggttc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2505048 |
attcaagaccagactctcataccacaggttc |
2505078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University