View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_high_37 (Length: 204)
Name: NF9711_high_37
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_high_37 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 39480175 - 39480378
Alignment:
| Q |
1 |
ctgtgtttgccaagatcatagcagcaccgcctgcttccttcacagcttgacccttttctgatcttccgttgacacctcgatcacataccaccatttttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480175 |
ctgtgtttgccaagatcatagcagcaccacctgcttccttcacagcttgacccttttctgatcttccgttgacacctcgatcacataccaccatttttcc |
39480274 |
T |
 |
| Q |
101 |
ttgaactttgtcctttggaagagaccctttgaggcaaaattgactctcactatccccaccagagaggtaaaccagctcaagttctttgctattgcttgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480275 |
ttgaactttgtcctttggaagagaccctttgaggcaaaattgactctcactatccccaccagagaggtaaaccagctcaagttctttgctattgcttgct |
39480374 |
T |
 |
| Q |
201 |
attc |
204 |
Q |
| |
|
|||| |
|
|
| T |
39480375 |
attc |
39480378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 39127250 - 39127051
Alignment:
| Q |
1 |
ctgtgtttgccaagatcatagcagcaccgcctgcttccttcacagcttgacccttttctgatcttccgttgacacctcgatcacataccaccatttttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||| || | |||||| |||||| |||||||||||||||||||||| |||||||||| ||| |||| ||| |||| || |
|
|
| T |
39127250 |
ctgtgtttgccaagatcatagcagtactacttgcttcattcacaacttgacccttttctgatcttccattgacacctcaatcgcatatgaccgttttgcc |
39127151 |
T |
 |
| Q |
101 |
ttgaactttgtcctttggaagagaccctttgaggcaaaattgactctcactatccccaccagagaggtaaaccagctcaagttctttgctattgcttgct |
200 |
Q |
| |
|
||||| |||| ||||||||||||| ||||||| |||||||||||||||||| |||||| ||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
39127150 |
ttgaaatttgacctttggaagaga-gtattgaggc-aaattgactctcactatctccaccacttaggtaaaccggctcaagttctttgccattgcttgct |
39127053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University