View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_30 (Length: 331)
Name: NF9711_low_30
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 14844307 - 14843990
Alignment:
| Q |
1 |
atggtagatctctagaaatttatatccacgtgtgtactaaatgatgtaatccttaatatcagaatttagacaccagccaagtaaaatatataacttagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14844307 |
atggtagatctctagaaatttatatccacgtgtgtactaaatgatgtaatccttaatatcagaatttagacaccagccaagtaaaatatataacttagat |
14844208 |
T |
 |
| Q |
101 |
tatcttttcttcagagttgttaaatgacgaccagaatggcgccattggccgcgcaatgacatgttttttacgacttatttttgacattttgccatattcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14844207 |
tatcttttcttcagagttgttaaatgacgaccagaatggcgccattggc--cgcaatggcatgttttttacgacttatttttgacattttgccatattcc |
14844110 |
T |
 |
| Q |
201 |
a-ccattgacaacacttttactactaatgattttcttatcttttgcatttgcagtaagcgccatcagatggcgatgatggaaggccagattttttcttta |
299 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14844109 |
acccattgacaacacttttactactaatgattttcttatcttttgcatttgcagtaagcgtcatcagatggcgatgatggaaggccagattttttcttta |
14844010 |
T |
 |
| Q |
300 |
taaacacaatgttgcagcct |
319 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14844009 |
taaacacaatgttgcagcct |
14843990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University