View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_41 (Length: 272)
Name: NF9711_low_41
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 45 - 254
Target Start/End: Complemental strand, 12559512 - 12559302
Alignment:
| Q |
45 |
agtatatgccttgtattaaagtcctggctaatataatcactatcatatggtgctcttcatatgaaaaa-ccgcaaactttggctttttccaaaaaattga |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12559512 |
agtatatgccttgtattaaagtcctggctaacataatcactatcatatggtgctcttcataagaaaaaaccgcaaactttggctttttccaaaaaattga |
12559413 |
T |
 |
| Q |
144 |
ttggtgtgatgaaacaagacgagaagtgaaggagctttcacaccataattatagaaattaactagctagaaatcaagcatagcgttgaagaaaatagtgg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559412 |
ttggtgtgatgaaacaagacgagaagtgaaggagctttcacaccataattatagaaattaactagctagaaatcaagcatagcgttgaagaaaatagtgg |
12559313 |
T |
 |
| Q |
244 |
aagtatatgat |
254 |
Q |
| |
|
||||||||||| |
|
|
| T |
12559312 |
aagtatatgat |
12559302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University