View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_43 (Length: 269)
Name: NF9711_low_43
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 34397261 - 34397514
Alignment:
| Q |
1 |
gttttatgctgcagctaggagtaagaattctgaggtattcaacatgattcttgattttgctctcttaggaaaagattgtggtattgttgaattggatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34397261 |
gttttatgctgcagctaggagtaagaattctgaggtattcaacatgattcttgattttgctctcttaggaaaagattgtggtattgttgaattggatgaa |
34397360 |
T |
 |
| Q |
101 |
ggtgttggtggtggagttttcaagagggagatattgaatagggccattcatgctgctgctagaggagggaattgggaaatacttaagaagcagcttcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34397361 |
ggtgttggtggtggagttttcaagagggagatattgaatagggccattcatgctgctgctagaggagggaattgggaaatactaaagaagcagcttcttt |
34397460 |
T |
 |
| Q |
201 |
tagtaagtgcttctcagattttatcttatagagatgttcaaggatgtactgtct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34397461 |
tagtaagtgcttctcagattttatcttatagagatgttcaaggatgtactgtct |
34397514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 147 - 183
Target Start/End: Complemental strand, 38831418 - 38831382
Alignment:
| Q |
147 |
ttcatgctgctgctagaggagggaattgggaaatact |
183 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
38831418 |
ttcatgctgctgctagaggtgggaattgggagatact |
38831382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University