View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_46 (Length: 261)
Name: NF9711_low_46
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 106 - 245
Target Start/End: Complemental strand, 37333484 - 37333345
Alignment:
| Q |
106 |
atatagttacaagaaagaaagnnnnnnngtatgcactttaaaatttaggctctagtcgcttctccgtgcgcacaccctccggttcgccccctgtatgccc |
205 |
Q |
| |
|
||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37333484 |
atatagttataagaaagaaagaaaaaatgtatgccctttaaaatttaggctctagtcgcttctccgcgcgcacaccctccggttcgccccctgtatgccc |
37333385 |
T |
 |
| Q |
206 |
attcaaaggagtagcatcatccttctccacaacatgtatt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37333384 |
attcaaaggagtagcatcatccttctccacaacatgtatt |
37333345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 204 - 245
Target Start/End: Complemental strand, 37324171 - 37324130
Alignment:
| Q |
204 |
ccattcaaaggagtagcatcatccttctccacaacatgtatt |
245 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37324171 |
ccatccaaaggagtagcatcaggcttctccacaacatgtatt |
37324130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University