View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_50 (Length: 251)
Name: NF9711_low_50
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 17 - 137
Target Start/End: Original strand, 30325181 - 30325301
Alignment:
| Q |
17 |
agaggaattgtacgtacaatcacctgttgtttgtcgttttcttgaatatccgtattttttggaatattatactcctcaatcatttttaccattatatcca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325181 |
agaggaattgtacgtacaatcacctgttgtttgtcgttttcttgaatatccgtattttttggaatattatactcctcaatcatttttaccattatatcca |
30325280 |
T |
|
| Q |
117 |
tcaatttccgcatatcctccc |
137 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
30325281 |
tcaatttccacatatcctccc |
30325301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 90 - 125
Target Start/End: Original strand, 30336850 - 30336885
Alignment:
| Q |
90 |
cctcaatcatttttaccattatatccatcaatttcc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30336850 |
cctcaatcatttttaccattatatccatcaatttcc |
30336885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University