View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_54 (Length: 249)
Name: NF9711_low_54
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 4 - 239
Target Start/End: Original strand, 38629061 - 38629295
Alignment:
| Q |
4 |
acaccatggtaaagctctaactttcaacttgtaatagttttcttctaattataacacataaataacttcactatcaaatagtttggtaatctaattcaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38629061 |
acaccatggtaaagctctaactttcaacttgtaatagttttcttctaattataacacataaataacttcactatcaaatagtttggcaatctaattcaaa |
38629160 |
T |
 |
| Q |
104 |
tccagtataatatttatttaatattgtgttttatggattttctttttagagtttcatcaagcttactttcataaatgtattttagaaggtttggaccttt |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38629161 |
tccagtataatatt-atttaatattgtgttttatggattttctttttagagtttcatcaagcttactttcataaatgtattttagaaggtttggaccttt |
38629259 |
T |
 |
| Q |
204 |
cttttatggaaaaaagataaatcatttgtttctctg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38629260 |
cttttatggaaaaaagataaatcatttgtttctctg |
38629295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University