View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_58 (Length: 246)
Name: NF9711_low_58
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_58 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 39480655 - 39480426
Alignment:
| Q |
17 |
atcagagacggtgtggacgttctatccttgtctctaggcggtttcccggtgccactatatgatgatagtattgccattggaagctttcgagcaatggaga |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480655 |
atcagagatggtgtggacgttctatccttgtctctaggtggtttcccggtgccactatatgatgatagtattgccattggaagctttcgagcaatggaga |
39480556 |
T |
|
| Q |
117 |
aagggatttcagttatatgtgcggcaggaaacaatggcccaatggcgatgtctgttgccaatgatgctccttggattgcaactattggagcaagcacact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480555 |
aagggatttcagttatatgtgcggcaggaaacaatggcccaatggcgatgtctgttgccaatgatgctccttggattgcaactattggagcaagcacact |
39480456 |
T |
|
| Q |
217 |
tgacagaaaattcccagctatagttcgcat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39480455 |
tgacagaaaattcccagctatagttcgcat |
39480426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University