View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_63 (Length: 242)
Name: NF9711_low_63
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 2 - 209
Target Start/End: Original strand, 48434522 - 48434730
Alignment:
| Q |
2 |
cacttacattttgtttttgcatagaagttaaattttcaaagttttatttgaccgaaatcagggaagggtagaggtgaaatcgtgaaaataaattagaaaa |
101 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48434522 |
cacttacattttgtttttacatagaacttaaattttcaaagttttatttgaccgaaatcagggaagggtagaggtgaaatcgtgaaaataaattagaaaa |
48434621 |
T |
|
| Q |
102 |
catgacatattatttgtaaaatgttagaaaaggactgcaaattaatacagtattatcatatta-annnnnnnnngctgtactattttatagcattgcata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
48434622 |
catgacatattatttgtaaaatgttagaaaaggactgcaaattaatacagtattatcattttattttattttttgctgtactattttatagcattgcata |
48434721 |
T |
|
| Q |
201 |
atagtgtcg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
48434722 |
atagtgtcg |
48434730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University