View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_68 (Length: 240)
Name: NF9711_low_68
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 26041265 - 26041492
Alignment:
| Q |
1 |
ttacttcataaaa-ccccatagaaattaacgtcaaagttcttgaccaaagtttgtgcgtaaaatgacagtgtgatagtagcaatagtaagataagactca |
99 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
26041265 |
ttacttcataaaaaccccatagaaattaacgtcaaagttcttcaccaaagtttgtgcgtaaaat-----------agtagcaatagtaagataaaactca |
26041353 |
T |
 |
| Q |
100 |
cgttaagaagagcgtataaggtagcggcaagatcagaagcttcagcagtaatcctgtaagcaatatccccactcgaaatggcgtcgttcgcttcaaaaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26041354 |
cgttaagaagagcgtataaggtagcggcaagatcagaagcttcagcagtaatcctgtaagcaatatccccactcgaaatggcgtcattcgcttcaaaaaa |
26041453 |
T |
 |
| Q |
200 |
cgcaagttccctctgcatcacacgatcgaacacatgaac |
238 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26041454 |
cgtaagttccctctgcatcacacgatcgaacacatgaac |
26041492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University