View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_70 (Length: 239)
Name: NF9711_low_70
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 93 - 218
Target Start/End: Complemental strand, 49525806 - 49525675
Alignment:
| Q |
93 |
aaacaaagagggcctaagccaatgagagatgatttttaatacnnnnnnnta------gttttttgagaggtctaaagcttttggaaggttgtcgtgagag |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49525806 |
aaacaaagagggcctaagccaatgagagatgatttttaatacaagaaaaaaaaaacagttttttgagaggtctaaagcttttggaaggttgtcgtgagag |
49525707 |
T |
|
| Q |
187 |
tgcagaagcaacaggccgagttgcggtactgt |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
49525706 |
tgcagaagcaacaggccgggttgcggtactgt |
49525675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University